Transcript
HER-2/neu Expression and Gene Amplification in Gastrinomas
: Correlations with Tumor Biology, Growth, and
Aggressiveness
Stephan U. Goebel, Michiko Iwamoto, Mark Raffeld, et al.
Cancer Res 2002;62:3702-3710.
Updated Version
Cited Articles
Citing Articles
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
http://cancerres.aacrjournals.org/content/62/13/3702
This article cites 78 articles, 21 of which you can access for free at:
http://cancerres.aacrjournals.org/content/62/13/3702.full.html#ref-list-1
This article has been cited by 9 HighWire-hosted articles. Access the articles at:
http://cancerres.aacrjournals.org/content/62/13/3702.full.html#related-urls
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at
[email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at
[email protected].
Downloaded from cancerres.aacrjournals.org on June 28, 2012
Copyright © 2002 American Association for Cancer Research
[CANCER RESEARCH 62, 3702–3710, July 1, 2002]
HER-2/neu Expression and Gene Amplification in Gastrinomas: Correlations with
Tumor Biology, Growth, and Aggressiveness
Stephan U. Goebel,1 Michiko Iwamoto, Mark Raffeld, Fathia Gibril, Wei Hou, Jose Serrano, and Robert T. Jensen2
Digestive Diseases Branch, National Institute of Diabetes and Digestive and Kidney Diseases [S. U. G., M. I., F. G., W. H., J. S., R. T. J.] and Hematopathology Section,
Laboratory of Pathology, National Cancer Institute [M. R.], NIH, Bethesda, Maryland 20892
ABSTRACT
A proportion of gastrointestinal neuroendocrine tumors are aggressive;
however, little is known of molecular determinants of their growth, and
molecular studies have identified no useful prognostic factors. Overexpression of HER-2/neu is common in some nonendocrine tumors, frequently correlates with increased tumor aggressiveness, and can be used
as a basis of treatment with trastuzumab. Little is known of its expression
in malignant pancreatic endocrine tumors. In the present study HER-2/
neu gene amplification and expression was determined in 43 gastrinomas
from different patients. Results were correlated with clinical, laboratory,
and tumor characteristics including tumor growth. HER-2/neu gene amplification was assessed by differential PCR, mRNA levels assessed by
quantitative PCR, and protein by immunohistochemistry. Fourteen percent of patients had HER-2/neu gene amplification in tumors compared
with levels in their WBCs. HER-2/neu mRNA varied over a 700-fold
range. However, only 3% exceeded levels seen in normal pancreas, and
immunohistochemistry did not show protein overexpression in any tumor
(n ⴝ 10). HER-2/neu mRNA levels were significantly higher (P ⴝ 0.032)
in tumors associated with liver metastases but not with tumor location or
size. These results show that HER-2/neu amplification/overexpression
does not seem to play a role in the molecular pathogenesis of most
gastrinomas, as suggested in a previous study involving small numbers of
cases. However, mild gene amplification occurs in a subset, and overexpression is associated with aggressiveness. Therefore, HER-2/neu levels
could have prognostic significance as well as identify a patient subset with
gastrinomas who might benefit from trastuzumab treatment.
INTRODUCTION
PETs,3 including gastrinomas, resemble GI carcinoid tumors in
generally demonstrating slow growth (1–3). However, recent studies
show a significant subset of these tumors show aggressive growth,
leading to a shortened survival (1, 3– 8). In one recent study (8) no
tumor-related deaths occurred in patients with slow-growing gastrinomas, whereas 62% of those with aggressively growing tumors had
a tumor-related death. At present there are no clinical or laboratory
features that can predict in an individual patient whether a PET will
pursue an aggressive course (1–3). The identification of prognostic
factors might be of great benefit in treating these patients because
early aggressive antitumor treatment could be instituted, such as more
extensive surgical resection. Such a new approach is particularly
needed because the current treatment of patients with advanced malignant PETs is generally unsatisfactory (3, 8, 9).
In a number of nonendocrine tumors recent insights into their
molecular pathogenesis have identified cellular mechanisms involved
Received 1/9/02; accepted 4/22/02.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance with
18 U.S.C. Section 1734 solely to indicate this fact.
1
Present address: Klinik II und Poliklinik fu¨r Innere Medizin, Universita¨t zu Ko¨ln,
Cologne, Germany D-50923.
2
To whom requests for reprints should be addressed, at NIH/National Institutes of
Diabetes, Digestive and Kidney Diseases/Digestive Diseases Branch, Building 10, Room
9C-103, 10 Center Drive, MSC 1804, Bethesda, MD 20892-1804. Phone: (301) 496-4201;
Fax: (301) 402-0600; E-mail:
[email protected].
3
The abbreviations used are: PET, pancreatic endocrine tumor; GI, gastrointestinal;
MEN1, multiple endocrine neoplasia type 1; FBS, fetal bovine serum; HPRT, hypoxanthine phosphoribosyltransferase; BAO, basal acid output; MAO, maximal stimulated acid
output.
in tumor invasiveness and led to identification of prognostic factors,
as well as new forms of treatment. In many nonendocrine tumors,
activation of oncogenes or inactivation of tumor suppressor genes is
important in their pathogenesis and/or behavior (10, 11). However, in
typical PETs and carcinoids alterations of common oncogenes (ras,
myc, src, etc.) or inactivation of common tumor suppressor genes (p53
and retinoblastoma) are uncommon (12–16). Mutations in the MEN1
tumor suppressor gene occur in 16 – 40% of sporadic PETs and 18%
of sporadic GI carcinoids (12, 13, 15–18). Recently, inactivation of
the tumor suppressor gene p16INK4a/CDKN2A is reported in some GI
neuroendocrine tumors (19, 20), with 50 –52% of gastrinomas showing methylation of 5⬘-CpG islands in the p16INK4a/CDKN2A gene and
0 – 40% having homozygous deletions in this gene (17, 20, 21).
Genetic alterations are reported in the tumor suppressor gene DPC4/
Smad4 in 55% of nonfunctional PETs but not in functional PETs (22).
These results show that inactivation of the p16INK4a/CDKN2A gene
and MEN1 gene mutations are likely important in the molecular
pathogenesis of a subset of PETs and carcinoids. However, in a
significant proportion of these tumors no molecular alterations in
these genes are found, and the molecular pathogenesis is unknown
(16). Furthermore, neither mutations in the MEN1 gene nor alterations
in the p16INK4a/CDKN2A gene are predictive of aggressive behavior
in PETs (17, 19). Therefore, studies of molecular pathogenesis of
PETs/carcinoids have not identified any prognostic factor that is
generally useful in an individual patient (16).
The HER-2/neu gene is a member of the Erb-like oncogene family
that maps to chromosome 17q21 (23, 24). This gene encodes a Mr
185,000 protein (p185) with tyrosine kinase activity, which structurally resembles other members of the four-member family of epidermal
growth factor receptor-related growth factor receptor family [epidermal growth factor receptor, HER-1(c-erb-B1), Her-3(c-erb-B3), and
HER-4 (c-erb-B4)]. Overexpression of the HER-2/neu protein has
been shown in experimental studies to be an important determinant of
malignant transformation, development of metastatic disease, and
increased cell proliferation (23, 24). Overexpression of the HER-2/
neu protein has been identified in a number of nonendocrine (breast,
pancreatic gastric, esophageal, prostate, and colon cancers; Refs. 23,
25–27) and a few endocrine tumors (thyroid, pituitary, and pheochromocytomas; Refs. 28 –33). Furthermore, overexpression of the
HER-2/neu protein correlates inversely with survival, and directly
with increased invasiveness and aggressive growth in a number of
these nonendocrine tumors (23, 25–27), and in one study in an
endocrine cancer (thyroid cancer; Ref. 33). This has led to the development and approval by the Food and Drug Administration of a
humanized monoclonal antibody against the HER-2/neu protein [trastuzumab (Herceptin)] that is now used for treatment of breast cancer
(23, 24, 34). The demonstration of overexpression of HER-2/neu in
other tumors would potentially make them amenable to treatment with
trastuzumab (25, 35, 36).
There are only a few studies involving small numbers of cases of
HER-2/neu gene amplification/protein overexpression in PETs and/or
carcinoids, and they have given contradictory results (16). Some
studies report an increase is frequently present in HER-2/neu gene
amplification/protein overexpression, whereas others report either no
3702
Downloaded from cancerres.aacrjournals.org on June 28, 2012
Copyright © 2002 American Association for Cancer Research
HER-2/NEU EXPRESSION IN GASTRINOMA
change or only that infrequently was an increase seen (20, 29, 37– 41).
Therefore, the current study was designed to examine whether
HER-2/neu gene amplification and/or overexpression occurred in
gastrinomas, which are the most common functional malignant
PET (9, 42). Sufficient numbers of cases were included, which had
been followed long term to allow correlations with tumor growth
patterns. Such correlations allowed us to assess whether levels of
expression of this proto-oncogene might be useful either prognostically for identifying patients with aggressive disease or possibly
for identifying a subset that possibly might benefit from trastuzumab treatment.
MATERIALS AND METHODS
Patients
Forty-three patients who underwent exploratory laparotomy for sporadic
Zollinger-Ellison syndrome at the NIH between 1990 and 1998, and who had
a gastrinoma resected or biopsied were included in this study. The study
protocol was approved by the Institutional Review Board of the National
Institute of Diabetes and Digestive and Kidney Diseases, and all of the patients
gave informed consent. The diagnosis of Zollinger-Ellison syndrome was
established as reported previously (43). Serum gastrin levels were analyzed by
RIA by Bioscience Laboratories (New York, NY) or Mayo Clinic Laboratories
(Rochester, MN). The duration of disease was defined as the time from onset
of continuous symptoms compatible with Zollinger-Ellison syndrome to surgery (44). A negative family history and lack of laboratory evidence of other
endocrinopathies on yearly evaluation, as described previously (45), diagnosed
the absence of MEN1. Duration of disease was defined by the clinical history
from the time of symptom onset as described previously (7). All of the patients
underwent an exploratory laparotomy with an extensive intraoperative evaluation for attempted curative resection, and determination of the primary tumor
site and size (46). Tumor volume at time of surgery was determined by
measuring the individual tumor lesions removed during surgery (8). Postoperatively the patients were reassessed within 2 weeks of surgery and in 3– 6
months to determine disease activity, and then annually to monitor for progression of disease (43). Tumor growth postoperatively was defined as an
increase in size or number of lesions on annual imaging studies and continued
evidence of active disease. As part of previous studies from our institution
some of the tumors had been analyzed for mutations in the MEN1 gene (17)
and alterations of the p16 gene (19), and these results were correlated with the
HER-2/neu expression levels found in this study.
Cell Lines
The breast cancer cell lines (SK-BR-3, BT474, MDA-MB-453, BT483,
BT20, and MDA-MB-468) were obtained from American Type Culture Collection (Rockville, MD). MDA-MB-453 and MDA-MB-468 were grown in
DMEM and 10% FBS; SK-BR-3 was grown in McCoy’s 5A medium with
10% FBS; BT474 and BT483 were grown in RPMI 1640 with 10% FBS and
10 g/ml bovine insulin, and BT 20 was grown in Eagle’s minimal essential
medium with 10% FBS.
Tumors
of the IFN-␥ gene was produced using the following primers: sense, TCTTTTCTTTCCCGATAGGT; antisense, CAGGGATGCTCTTCGACCTC. Both
fragments were amplified in the same vial using the following conditions:
94°C for 10 min and 35 cycles of 94°C, 50°C, and 70°C for 1 min each in a
thermocycler (9700; Perkin-Elmer Corp.). Bands were separated on 10%
polyacrylamide gels, stained with ethidium bromide, and band intensities were
measured with an image analysis program (NIH-IMAGE).4
RNA Quantitation. Tumor RNA was extracted from 8-m cryosections of
the specimens using a commercial kit (RNeasy Mini kit; Qiagen Inc.) after
analyzing an adjacent slide with H&E staining to determine that the slides
contained ⬎80% tumor tissue. Purified pancreas RNA was purchased from
Clontech (Clontech, Palo Alto, CA), and RNA was isolated from four breast
cancer cell lines SK-BR-3, BT474, MDAMB453, and BT 483 (American Type
Culture Collection) using a commercial kit (Trizol; Life Technologies, Inc.
Grand Island, NY). Random hexamer-primed first-strand cDNA was prepared
with reverse transcription (RNA PCR kit; Perkin-Elmer, Foster City, CA). The
integrity of the cDNA was assessed by detecting a diffuse smear from 0.6 to
3 Kb. After reverse transcription, PCR was carried out for amplification of a
270-bp fragment of the human HER-2/neu oncogene cDNA with the following
primers: sense (S), 5⬘-GAAATCTTAGACGAAGCATACG-3⬘ corresponding
to nucleotides 2470 –2491 of the human c-erb--2 mRNA (GenBank accession
no. 03363), and antisense (AS), 5⬘-ACTCTTGACCAGCACGTTCC-3⬘ corresponding to nucleotides 2720 –2739. PCR was run under the following conditions: 94°C for 10 min, 32 cycles of 94°C, 60°C and 72°C for 50 s each, and
final extension at 72°C for 5 min. Using the same PCR conditions except for
the addition of 10% DMSO a 204-bp fragment of the human -actin gene
cDNA was amplified with these primers: S, 5⬘-CCTCGCCTTTGCCGATCC-3⬘ and AS, 5⬘-GGAATCCTTCTGACCCATGC-3⬘, which corresponds to 25– 42 (sense) and 210 –229 (antisense) from Homo Sapiens actin 
(ACT) mRNA (GenBank accession no. XM037235-1). The mimics for
competitive PCR were constructed using intronic sequences of the HPRT gene
to make different size products. For preparation of the HER-2/neu oncogene
mimic (233 bp) a fragment of the HPRT gene of 193 bp was amplified using
sense primers: 5⬘-TCCTCGAGATGTGATGAAGG-3⬘ and antisense primers:
5⬘-TCCCCTGTTGACTGGTCATT-3⬘, which correspond to nucleotides
16615–16634 (sense) and 27892–27911 (antisense) of the HPRT gene
(GenBank accession no. M26434). This product was then amplified using
gene-specific HER-2/neu primers: sense, 5⬘-AAATCTTAGACGAAGCATACGTGCTCGAGATGTGATGAAGG-3⬘ and antisense, 5⬘-ACTCTTGACCAGCACGTTCCTCCCCTGTTGACTGGTCATT-3⬘, to obtain the
233-bp HER-2/neu mimic. To obtain the 289-bp -actin mimic, a 249-bp
fragment of the HPRT gene was amplified using: sense, 5⬘-CATTGTAGCCCTCTGTGTGC-3⬘ and antisense, 5⬘-CTGCATTGTTTTGCCAGTGT-3⬘
corresponding to nucleotides 16651–16670 (sense) and 34948 –34967
(antisense) of the HPRT gene (GenBank accession no. M26434). This
product was then amplified using -actin gene-specific primers: sense,
5⬘-CCTCGCCTTTGCCGATCCGCATTGTAGCCCTCTGTGTGC-3⬘ and
antisense, 5⬘-TGCTATCCCTGTACGCCTCTCTGCATTGTTTTGCCAGTGT-3⬘ to obtain the 289-bp -actin mimic. Stock solutions of the mimics
were prepared by purifying the PCR solutions with a Microcon 30 Filter
(Amicon Inc., Beverly, MA). The concentrations of the mimic stock
solutions were determined by measuring the absorbance at 260 nm in a
spectrophotometer (Beckman Coulter Inc., Columbia, MD) and serial dilutions prepared. Competitive PCR was performed by adding 1 l of cDNA
solution to 1 l of serial mimic-dilutions with the respective primer pairs
(HER-2/neu-S/AS or -actin-S/AS) under the appropriate PCR conditions.
Initially log dilutions of the mimics were used, then serial dilutions of 25%,
50%, and 75% for each log unit to obtain a more precise standard curve to
calculate the amount of mRNA present. The amount of measured target
mRNA was determined by calculating the concentration of the mimic that
resulted in equal intensity of ethidium bromide staining in a 1% agarose
gel. Results of the competitive PCR were expressed as the ratio of the
number of molecules of the HER-2/neu mRNA to -actin mRNA present.
Immunohistochemistry. Immunohistochemical staining was performed
using the Hercept-kit (Dako Corp.) and an automated immunostainer (Ventana
Medical Systems, Inc., Tucson, AZ) according to the company’s protocols.
Differential PCR. Tumor samples were immediately snap frozen in liquid
nitrogen during surgery and stored at ⫺70°C. Tumor DNA was extracted from
8-m cryosections of the specimens using a commercial kit (QiAmp Blood kit;
Qiagen Inc., Santa Clarita, CA) after analyzing an adjacent slide with H&E
staining to determine the extent of normal tissue present. Specimens with a
tumor content of ⬍80% of the entire tissue were dissected to enrich the tumor
fraction. Germ-line DNA was extracted using the same kit from leukocytes of
17 of these patients. DNA from the breast cancer cell line SK-BR-3 was
extracted after the third passage of cells using the same kit. Differential PCR
to determine the gene copy number of the HER-2/neu oncogene compared with
the single copy gene IFN-␥ was performed according to the method described
by Frye et al., (47). Briefly, a 98-bp fragment of the HER-2/neu oncogene was
amplified using the following primers: sense, CCTCTGACGTCCATCATCTC; antisense, ATCTTCTCGTGCCGTCGCTT, and a 150-bp fragment
3703
4
Internet address: http://rsb.info.nih.gov/nih-image.
Downloaded from cancerres.aacrjournals.org on June 28, 2012
Copyright © 2002 American Association for Cancer Research
HER-2/NEU EXPRESSION IN GASTRINOMA
Briefly, 8-m thick paraffin sections were mounted on plain glass slides. After
deparaffinization and rehydration the slides were placed in a microwave
pressure cooker in 0.01 M citrate buffer (pH 6.0; Biogenex, San Ramon, CA.)
containing 0.1% Tween 20 and heated in a microwave oven at maximum
power (900 W) for 40 min. Sections were immediately cooled in Tris-buffered
saline (0.05 M; pH 7.6). Thereafter, all of the sections were washed in
Tris-buffered saline (pH 7.6) containing 5% goat serum (Life Technologies,
Inc.) for 30 min. Slides were incubated with the primary polyclonal antibody
A0485 (Hercept; Dako Corp.) in a dilution of 1:500 for 12 h at room
temperature. The rest of the procedure (secondary antibody, avidin-biotin
complex, color development, and counterstain) was performed on the Ventana
immunostainer.
RESULTS
The clinical and laboratory characteristics of the 43 patients studied are
similar to other series of patients with Zollinger-Ellison syndrome (44,
48 –51) with respect to a slight male predominance (62%), mean age of
patients at surgery in the fifth decade (48 year), and long duration of
disease (9 year; Table 1). All of the patients had either an elevated fasting
serum gastrin level or an abnormal secretin-stimulated gastrin provocative test, and the majority had a markedly elevated preoperative BAO and
MAO (51, 52). The location and extent of the tumor encountered during
surgery was comparable with other recent surgical series (46, 53) in that
the duodenum was the primary tumor site in almost half the patients
(42%), and in the remaining patients the primary tumor site was equally
distributed between the pancreas, lymph nodes, and other sites (Table 1).
In 2 patients only lymph node metastases were found at surgery without
Table 1 Clinical and laboratory characteristics of patients studied
a
Characteristic
Number (%)
Patients
Male gender
Age (yrs)a
Mean ⫾ SE
[Range]
Duration of diseaseb
Mean ⫾ SE
[Range]
Preoperative fasting serum gastrin (pg/ml)
Mean ⫾ SE
[Range]
Median
Preoperative BAO (mEq/h)c
Mean ⫾ SE
[Range]
Preoperative MAO (mEq/h)c
Mean ⫾ SE
[Range]
Primary tumor locationd
Duodenum
Pancreas
Lymph noded
Othere
Surgical outcome
Disease-free
Not disease-free
Tumor growth patternf
No growth
Growth
New liver metastases
43
27 (62%)
48.2 ⫾ 1.5
[15–62]
8.9 ⫾ 1.1
[0.2–35]
5151 ⫾ 260
[87–110000]
746
44 ⫾ 3.6
[10–92]
69 ⫾ 5.4
[23–135]
18 (42%)
8 (19%)
10 (23%)
7 (16%)
21 (49%)
22 (51%)
13 (60%)
6 (27%)
3 (14%)
Age at time of surgery.
Duration of disease is defined as time from onset of persistent symptoms compatible
with gastric acid hypersecretion to surgery (7).
c
BAO and MAO are from the 36 patients without previous acid-reducing surgery.
d
Primary tumor location was determined during surgery (46). Lymph node primary
indicates a gastrinoma resected in lymph node only and a disease-free status postoperatively (92).
e
Other primary tumor locations include: heart (n ⫽ 1), bile ducts (n ⫽ 1), liver (n ⫽ 3),
and unknown (n ⫽ 2).
f
Tumor growth pattern was defined by annual evaluations with imaging studies (17)
(computed tomography, magnetic resonance imaging, and SRS (Somatostatin receptor
scintigraphy). Growth was defined as an increase in size of lesion or number of imaging
lesions as defined in “Materials and Methods” (17).
b
Fig. 1. Examples and results of differential PCR for HER-2/neu gene amplification.
Left panel, ethidium bromide staining of the differential PCR for the HER-2/neu and
IFN-␥ genes from a breast cancer cell line (SK-BR-3; positive control), 4 gastrinomas, and
leukocytes from the same patients in a 10% agarose gel. MW indicates the molecular
weight marker, and the number below the bands represents the ratio of neu:IFN-␥ as
measured by absorbance in the respective lane. Right panel, results of differential PCR
from all patients. Data are expressed as the ratio of the neu:IFN-␥ result for each sample.
Shown are results from 43 gastrinomas (F) from 43 different patients, WBC DNA results
from the first 17 patients (K) and the breast cancer (SK-BR-3; 䡺), which is reported to
have increased HER-2/neu gene copy number (54 –56). The 䡠䡠䡠 represents the upper limit
of normal (P ⬍ 0.025) calculated from the WBC sample mean ⫹3 SDs (0.86);
bars, ⫾ SD. The horizontal lines are means and vertical lines are 1 SE.
a primary tumor localized. During the postoperative follow-up of
3.1 ⫾ 0.4, one-half the patients remained disease free (Table 1). Of the 22
patients that were not disease-free after the resection almost two-thirds of
the tumors did not show any growth during the postoperative follow-up.
In 40% of the patients not cured the tumors displayed growth, and the
tumor in 3 of these patients demonstrated aggressive growth with the
development of liver metastases during the postresection follow-up time
(Table 1).
DNA was extracted from all 43 of the tumors (the primary or a
regional lymph node metastasis), leukocytes from 17 of these patients,
and from the breast cancer cell line SK-BR-3, which is reported to
have amplification of the HER-2/neu gene copy number (54 –57) for
differential PCR of the HER-2/neu and IFN-␥ genes. Fig. 1 (left
panel) shows an example of the differential PCR result from 4 patients
and from the SK-BR-3 breast cancer cells. Differential PCR demonstrated a 3-fold amplification of the HER-2/neu oncogene over the
IFN-␥ gene in the breast cancer cell line SK-BR-3 (Fig. 1, top left
panel). However, in the 4 gastrinomas (Fig. 1, middle left panel) the
intensity of the HER-2/neu band was less than that of the IFN-␥ band;
therefore, the HER-2:IFN-␥ ratio was ⬍1, indicating no amplification
of the HER-2/neu oncogene relative to the IFN-␥ gene in any of the
gastrinomas if this criteria of overamplification is used (58 – 61). In
the WBCs from the same 4 patients (Fig. 1, bottom left panel),
similarly no amplification of the HER-2/neu oncogene over the IFN-␥
gene was seen using a ratio ⬎1. In the first 17 patients both the
gastrinoma and WBC HER-2:IFN-␥ ratio were determined using
differential PCR, and the presence of the two genes was not significantly different in both tissues (tumor versus WBC: 0.60 ⫾ 0.03
versus 0.62 ⫾ 0.02; Fig. 1, right panel). Using the SD of the
HER-2:IFN-␥ ratio for the leukocytes in these 17 patients a 97.5%
confidence interval was calculated (Fig. 1, right panel). Gastrinomas
from 6 patients had a significantly higher HER-2:IFN-␥ ratio than
the ⬎ mean ⫹3 SD of the leukocytes (i.e., ⬎0.86; P ⬍ 0.025; Fig. 1,
right panel). In none of the tumor specimens was the ratio ⬎1.5-times
3704
Downloaded from cancerres.aacrjournals.org on June 28, 2012
Copyright © 2002 American Association for Cancer Research
HER-2/NEU EXPRESSION IN GASTRINOMA
Fig. 2. Ethidium bromide staining of the competitive PCR for the HER-2/neu from the
tumors of 2 patients in a 1% agarose gel. The arrow indicates where the calculated amount
of unknown equals the amount of competitor and represented the amount of HER-2/neu
in the unknown sample. In the top panel this was determined to be 60 molecules in the 1
l volume of tumor sample added, and in the bottom panel it was determined to be 38
molecules/1 l volume of tumor sample added.
the ratio in nontumor cells, ⬎1, and in no patient gastrinoma did the
ratio approach the 3.2-fold amplification seen in the SK-BR-3 breast
cancer cell line (Fig. 1, right panel).
RNA of sufficient quality and quantity for amplification of the
HER-2/neu and -actin transcripts was available from gastrinomas
from 33 patients. Fig. 2 shows an example of the competitive PCR for
the determination of the HER-2/neu transcript amount from 2 patients.
Where the intensity of the ethidium bromide staining of the upper
band is calculated to equal that of the lower band is the amount of
molecules in the unknown sample. A similar competitive PCR was
performed to determine the amount of -actin in each sample. Using
the dilution of the sample added, the number of molecules of
HER-2/neu and -actin were determined in all of the samples and
expressed as a ratio (i.e., neu:-actin ratio; Fig. 3). The amount
detected in the gastrinomas varied over a 700-fold range from 0.00029
to 0.19 with a mean of 0.0193 ⫾ 0.007 neu molecules per -actin
molecule (Fig. 3). In tissue from 4 normal pancreas the ratio for
HER-2/neu over -actin expression varied over a 4.5-fold range from
0.0275 to 0.125 with a mean of 0.075 ⫾ 0.032 HER-2/neu molecule
per -actin molecule (Fig. 3, middle column). In contrast, in the four
breast cancer cell lines known to overexpress HER-2/neu (SK-BR-3,
BT474, MDA-MB453, and BT483; Refs. 54, 56, 62) significantly
more HER-2/neu molecules per -actin molecule were found compared with two cell lines not overexpressing HER-2/neu (BT20 and
MDA-MB468; Refs. 54, 62; Fig. 3, right column). When a 95%
coefficient interval for the relative expression of HER-2/neu compared with -actin was calculated from normal pancreas only 1of 33
(3%) gastrinomas exceeded this range (Fig. 3, left panel).
HER-2/neu overexpression is known to correlate with tumor aggressiveness, prognosis, and invasiveness in some endocrine (thyroid
cancer and pheochromocytomas) and nonendocrine (breast, gastric,
pancreatic, and esophageal) cancers (23, 25, 26, 30, 31, 33). Therefore, we compared the amount of HER-2/neu expression with the
presence or absence of various clinical, laboratory, and tumoral features reported to correlate with malignant behavior of gastrinomas
and/or PETs (Refs. 1, 6, 7; Fig. 4). No clinical (gender, curability, and
disease duration) or laboratory (fasting gastrin level) parameter
showed a significant correlation with the amount of HER-2/neu
mRNA expression in the gastrinomas (Fig. 4, upper right panel).
Significantly higher expression of the HER-2/neu mRNA was found
in gastrinomas (i.e., the primary or from a regional metastatic lymph
node) associated with liver metastases (P ⫽ 0.032) although the
numbers were small. Whether the HER-2/neu expression was the
same in the primary and its liver metastases was unknown because
insufficient tissue was available from liver metastases because their
presence was established by cytology with immunocytochemical analysis. The presence of other tumoral characteristics reported to be
associated with aggressive behavior (1, 6, 7) such as nonduodenal
primary tumor location, increased tumor size, increased number of
tumor sites, or tumor volume were not associated with increased
HER-2/neu mRNA expression (Fig. 4, left panel). Similarly, the
presence or absence of other genetic abnormalities (MEN1 gene
mutation or p16INK4a gene promoter methylation) known to frequently occur in gastrinomas (15, 17, 19, 20) did not correlate with the
amount of HER-2/neu mRNA expression in the tumors (Fig. 4, lower
right panel).
To examine protein expression, immunohistochemistry with an
antibody directed against the membranous portion of the HER-2/neu
protein was performed using paraffin-embedded tissue from the breast
cancer cell line SK-BR-3, which is known to overexpress HER-2/neu
protein (56, 62, 63), normal pancreas, and 10 gastrinomas. Staining
showed a strong membranous staining pattern in virtually all of the
Fig. 3. Distribution of the amount of HER-2/neu mRNA present in gastrinomas, normal
pancreas, and positive controls. Quantitative PCR results were obtained from gastrinomas
from 33 patients (F; left column), four normal pancreas (E), and six breast cancer cell
lines (BT 20, MDAMB468, SK-BR-3, BT474, MDAMB453, and BT 483; right column).
Four cell lines (SK-BR-3, BT474, MDAMB453, and BT 483; half-filled squares) are
reported to overexpress HER-2/neu and two cell lines (䡺) not to overexpress the
HER-2/neu gene (54, 56, 62). The horizontal line with vertical bars represents the mean
for the neu:-actin ratio determined by quantitative PCR in the gastrinomas; bars, ⫾ SE.
The 䡠䡠䡠 is the 95% confidence interval (mean ⫹2 SD) for the normal pancreas (i.e., 0.185).
3705
Downloaded from cancerres.aacrjournals.org on June 28, 2012
Copyright © 2002 American Association for Cancer Research
HER-2/NEU EXPRESSION IN GASTRINOMA
Fig. 4. Comparison of HER-2/neu mRNA levels in gastrinomas with the presence or absence of various clinical parameters, tumor location, tumor extent, tumor growth behavior,
and genetic alterations. The number of patients in each category is shown in parentheses. “Disease-free” was defined by a normal fasting serum gastrin level, a negative secretin test,
and no imageable disease postresection. Primary tumor location was determined at surgery in all patients. Results of genetic analyses of other genes (MEN1 and p16) were from previous
reports (17, 19). ⴱ indicates P ⬍ 0.05.
breast cancer cells (Fig. 5, top left). In the normal pancreas removed
during surgery from one of the patients with a gastrinoma, a few
normal islet cells stained with the antibody (Fig. 5, bottom left). This
indicated that our tissue samples still contained the HER-2/neu antigen and therefore any lack of immunostaining in gastrinomas was not
likely because of damage to the tissue, which can occur during storage
(37, 39, 64). In the normal pancreas some of the islet cells and entire
exocrine pancreas were devoid of any positive HER-2/neu staining
(Fig. 5, bottom left). Similarly, in each of the 10 gastrinomas examined no immunohistochemical staining with the HER-2/neu antibody
could be detected in the tumor. Examples of two of the gastrinomas
with negative staining are shown in Fig. 5 (right column). Two
gastrinomas that had slightly elevated HER-2/neu:IFN-␥ ratios
(Patients 38 and 40) were included in those studied by immunocytochemistry and each was negative for HER-2/neu staining in the tumor.
DISCUSSION
The purpose of the present study was to assess the frequency of
amplification of HER-2/neu gene and possible overexpression of its
products in gastrinomas. The identification of a subset of patients with
gastrinomas overexpressing either the HER-2/neu gene and/or its
product might be clinically useful for management of these patients.
HER-2/neu amplification/overexpression might prove to be an
independent predictor of the growth behavior of the gastrinoma as it
has for a number of nonendocrine tumors (23, 25, 26). Secondly,
HER-2/neu amplification/overexpression could provide the basis to
consider treatment of this subset of patients with the HER-2/neu
humanized monoclonal antibody, trastuzumab. Trastuzumab, either
alone or in combination with other antitumor agents, is currently being
used in patients with breast cancer (23, 34) and considered for use
in other cancers with HER-2/neu amplification/overexpression (25,
35, 65).
Our results demonstrate that HER-2/neu gene amplification is uncommon in gastrinomas, and when it occurs it is only a minimal
increase compared with the magnitude of the overexpression in other
tumors. Differential PCR was used, which is one of the established
methods to detect amplification of the HER-2/neu oncogene (47, 58,
66). Using this method, none of the 43 gastrinomas in the present
study demonstrated amplification of the HER-2/neu oncogene to a
level greater than the single copy IFN-␥ gene in any of the tumors.
However, in 14% of the tumors (i.e., 6 of 43) the ratio of HER-2/neu
oncogene to IFN-␥ exceeded by 3 SDs the mean of the ratio for the
leukocyte DNA of the patients (P ⬍ 0.025), suggesting mild amplification of the HER-2/neu oncogene was present in these gastrinomas.
This level of HER-2/neu amplification is much less than the 2 to
⬎30-fold reported in gastric cancer (67), breast cancer (54, 58 – 60,
68), urinary bladder cancer (57, 61), and ovarian cancer (69). Furthermore, using the criterion of at least a 2-fold amplification, which
is used in many other studies for a positive result for HER-2/neu gene
amplification (58 – 61, 69), our findings in gastrinomas would be
interpreted as none of the gastrinomas showing significant HER-2/neu
gene amplification.
Our results differ from one study (40) that reported all 12 of the
gastrinomas studied demonstrated HER-2/neu gene amplification (2–
12-fold). However, they are in agreement with three other studies
(70 –72) involving small numbers of gastrinomas. In each of these
latter three studies (70 –72) comparative genomic hybridization was
used and identified no overexpression on chromosome 17q in gastrinomas, the location of the HER-2/neu gene. Similarly, in a study of 18
midgut carcinoids, which have many similarities to PETs, by com-
3706
Downloaded from cancerres.aacrjournals.org on June 28, 2012
Copyright © 2002 American Association for Cancer Research
HER-2/NEU EXPRESSION IN GASTRINOMA
Fig. 5. Immunohistochemistry of the HER-2/neu protein in a breast cancer cell line (SK-BR-3), normal pancreas, and gastrinomas from 2 patients at the same magnification (⫻100).
The top left panel shows strong membranous staining in all cells from the breast cancer cell line, SK-BR-3, which is known to overexpress HER-2/neu protein (55, 56, 63). The normal
pancreas from one of the gastrinoma patients demonstrates positive staining in a few islet cells (bottom left panel). Both gastrinomas (bottom and top right panel) show no HER-2/neu
staining, which is similar to the results in 8 other gastrinomas.
parative genomic hybridization, 0% demonstrated overexpression on
17q (73). Our results in gastrinomas are similar to results with other
endocrine tumors, which demonstrate no HER-2/neu gene amplification [pituitary, 0% (74); and thyroid cancer, 0% (28, 30, 75)] and
various nonendocrine tumors where HER-2/neu gene amplification
was uncommon [non-small cell lung cancer, 3% (76); prostate, 0%
(27, 77); and urinary bladder cancer, 4 – 8% (78, 79)]. However, our
results in gastrinomas differ from that reported in other PETs and in
some carcinoids. In these studies gains were seen on chromosome 17q
by comparative genomic hybridization in 55% of the tumors (n ⫽ 20)
in one study (71), 57% in a second study (n ⫽ 26; 70), and 41% in a
third study (n ⫽ 44) with one of two nongastrinoma PETs showing
overexpression of HER-2/neu gene by fluorescence in situ hybridization analysis (71). These results suggest that different PETs/carcinoids
may differ in the frequency with which HER-2/neu gene amplification
occurs and its role in their molecular pathogenesis. Our results with
gastrinomas also differ from findings in a number of nonendocrine
cancers where HER-2/neu gene amplification is not infrequent [breast,
10 –33% (60); gastric, 10 – 43% (25); esophageal, 35% (25); and
ovarian, 19 –59% (80)].
In some tumors such as breast cancer there is a close correlation
between HER-2/neu gene amplification, and overexpression of
HER-2/neu mRNA and/or protein (23, 56). However, with other
tumors [thyroid cancer (28), gastric cancer (67), prostate cancer (27),
and urinary bladder cancer (79)] overexpression of HER-2/neu
mRNA and/or protein occurs without HER-2/neu gene amplification.
Using assessments of HER-2/neu mRNA and/or protein levels, studies
suggest HER-2/neu overexpression is not important in some endocrine cancers [adrenocortical tumors, 0% (81); medullary thyroid
cancer, 0% (29, 82); and follicular thyroid cancer, 0% (83, 84)].
However, overexpression of HER-2/neu protein occurs frequently in
other endocrine cancers [papillary thyroid, 52–100% (33, 75, 84 – 86);
and pheochromocytomas, 48 –79% (29, 87)] and common nonendocrine tumors [esophageal, 23% (25); gastric, 33% (25); breast, 20%
(29, 39); and colon, 33% (25)]. To investigate the possibility that
HER-2/neu mRNA and/or protein overexpression could be occurring
in gastrinomas, as well as to determine whether the mild amplification
of the HER-2/neu gene in a subset of the gastrinomas resulted in
increased expression, the HER-2/neu mRNA levels were determined
by qualitative PCR in 33 gastrinomas in which frozen tissue existed
and HER-2/neu protein expression was examined by immunocytochemistry in a proportion of the tumors. Quantitative PCR was used
because studies demonstrate that immunocytochemical methods may
not be reliable for quantitative assessment of low levels of increased
HER-2/neu protein expression (23, 88). Furthermore, in both endocrine tumors including PETs and carcinoids (29), as well as some
nonendocrine cancers [i.e., gastric (89)] there was a close correlation
between HER-2/neu mRNA expression and protein expression. To
correct for small variations in both sample input and amount detected,
in our study, qualitative PCR was used for both determining the
amount of HER-2/neu mRNA and -actin present, and the result
normalized to the -actin amount. The relative amount of HER-2/neu
and -actin molecules expressed as the neu:-actin ratio varied
widely over a 700-fold range in gastrinomas. However, in only 3%
(1 of 33 gastrinomas) did the ratio exceed the upper limit of normal
for pancreatic tissue. Similarly none of the 10 gastrinomas, which all
had normal mRNA levels, overexpressed HER-2/neu protein on immunocytochemical analysis including 2 patients who had tumors with
slightly increased HER-2/neu gene amplification. These results are
similar to two other studies involving small numbers of gastrinomas,
which reported 1 of 6 tumors (17%; Ref. 37) and 0 of 20 (0%; Ref.
20), demonstrated HER-2/neu protein overexpression. These results
3707
Downloaded from cancerres.aacrjournals.org on June 28, 2012
Copyright © 2002 American Association for Cancer Research
HER-2/NEU EXPRESSION IN GASTRINOMA
are also similar to some studies involving other PETs and/or carcinoids, which reported 0 –9% (20, 38, 39, 72) but not others, which
reported 17–100% of the tumors (29, 37, 41, 90), demonstrated
HER-2/neu overexpression with increased membrane staining using
immunohistochemical methods. The findings in some of these studies
on various PETs/carcinoids at first appear to conflict with results from
a study involving 36 PETs examined by comparative genomic hybridization (72) in which 41% had amplification of chromosome 17q,
the location of the HER-2/neu gene. However, in that study (72) only
9% of the PETs with HER-2/neu gene amplification had overexpression of HER-2/neu protein by immunohistochemical studies. The
above results on HER-2/neu mRNA and/or protein expression in
gastrinomas are consistent with the conclusion that amplification of
the HER-2/neu gene or overexpression of its product do not seem to
be involved in the molecular pathogenesis of most gastrinomas.
In a number of both endocrine [thyroid cancer (30, 33) and pheochromocytomas (31)] and nonendocrine cancers [breast (23, 36, 56),
gastric (25), colon (25), andovarian (80)] amplification of the HER2/neu gene or overexpression of HER-2/neu mRNA/protein correlate
with aggressive growth, invasiveness, and/or decreased survival.
There is very limited information in PETs/carcinoids of the possible
role of HER-2/neu overexpression as a prognostic factor for tumor
growth behavior, and the two available studies have given conflicting
results. One study (41) involving 10 carcinoid tumors concluded that
HER-2/neu amplification may be an important prognostic factor for
tumor growth behavior. However, another study (37) involving small
numbers of PETs/carcinoids showed no relationship between overexpression of HER-2/neu and survival, tumor invasiveness, or presence
of liver metastases. In our study, the presence of various laboratory or
tumor characteristics reported to be associated with aggressive behavior of gastrinomas (1, 6, 7, 48, 91), such as male gender, high fasting
gastrin levels, short disease duration, large primary size, nonduodenal
primary location, or increased numbers of tumors, was not associated
with higher HER-2/neu mRNA levels. However, a significantly
higher expression of HER-2/neu mRNA was found in gastrinomas
associated with liver metastases (P ⫽ 0.032) although the numbers of
tumors in the different groups were small. These results suggest that
increased HER-2/neu expression is a factor in determining the aggressiveness of some gastrinomas. However, whether assessment of HER2/neu expression will be clinically useful as a prognostic factor in
these tumors is unclear, and until this is resolved, routine assessment
of its expression cannot be recommended. This uncertainty is attributable partially to the fact that the extent of overexpression is relatively modest compared with nonendocrine tumors (54, 58 – 60, 67,
69). This modest increase will make immunohistochemical assessment difficult because this method may be unreliable when HER-2/
neu overexpression is low (88), and, thus, to obtain meaningful data
careful quantitative assessment will be needed, which is time consuming and expensive. Nevertheless, there are very few prognostic
factors useful in an individual patient with a potentially malignant
PET/carcinoid, and current antitumor treatments once the disease
becomes advanced, are generally unsatisfactory (3, 8, 9, 12) . However, if an aggressive phenotype could be recognized earlier, more
aggressive surgical resection or early antitumor treatment could be
considered, which might improve survival. Therefore, additional studies correlating tumor growth with HER-2/neu mRNA levels in GI
carcinoids and PETs should be performed including a larger number
of patients.
In previous studies mutations in two tumor suppressor genes, the
MEN1 gene and the p16INK4a/CDKN2A gene, were reported in 16 –
90% of PETs and/or carcinoids (17, 19, 20, 20, 21). However, in none
of these studies was the presence of abnormalities in either of these
genes associated with increased tumor aggressiveness, liver metasta-
ses, or decreased survival. In the present study we found no correlation between the expression level of HER-2/neu in gastrinomas and
the occurrence of abnormalities in either of these two tumor suppressor genes, providing no support for a cooperative interaction of these
abnormalities in increasing gastrinoma aggressiveness.
In conclusion, our results do not provide evidence for a general role
for overexpression of either the HER-2/neu gene or its product in the
molecular pathogenesis of gastrinomas, in contrast to the suggestion
from a previous study (40) involving a few cases. However, our
results do show that minimal HER-2/neu gene amplification occurs in
a small subset (14%) of gastrinomas. Furthermore, significantly
higher HER-2/neu mRNA levels are found in more aggressive gastrinomas. Because the current treatments of advanced malignant
PETs/carcinoids are generally inadequate and because tumor progression is now the main determinant of survival in these patients (1, 6, 7),
the finding of higher levels of HER-2/neu mRNA in more aggressive
tumors raises the possibility it may be a useful prognostic factor as
well as the possibility these patients might benefit by trastuzumab
treatment, either alone or in combination with other agents. However,
before either of these two possibilities can be established it is important that HER-2/neu expression be assessed in a study containing
larger numbers of patients with progressive liver metastases. Because
most deaths occur in the subset with progressive metastatic disease
(8), the establishment that increased HER-2/neu expression occurs in
this subset or is predictive of entering this subset will strongly support
both its clinical importance and its use as a prognostic factor or basis
for antitumor treatment.
REFERENCES
1. Jensen, R. T. Natural history of digestive endocrine tumors. In: M. Mignon and J. F.
Colombel (eds.), Recent Advances in Pathophysiology and Management of Inflammatory Bowel Diseases and Digestive Endocrine Tumors, pp. 192–219. Paris: John
Libbey Eurotext, 1999.
2. Mignon, M. Natural history of neuroendocrine enteropancreatic tumors. Digestion,
62: 51–58, 2000.
3. Jensen, R. T., and Doherty, G. M. Carcinoid tumors and the carcinoid syndrome. In:
V. T. DeVita, Jr., S. Hellman, and S. A. Rosenberg (eds.), Cancer: Principles and
Practice of Oncology, 6th ed., pp. 1813–1833. Philadelphia: Lippincott Williams &
Wilkins, 2001.
4. Madeira, I., Terris, B., Voss, M., Denys, A., Sauvanet, A., Flejou, J. F., Vilgrain, V.,
Belghiti, J., Bernades, P., and Ruszniewski, P. Prognostic factors in patients with
endocrine tumors of the duodenopancreatic area. Gut, 43: 422– 427, 1998.
5. Stabile, B. E., and Passaro, E., Jr. Benign and malignant gastrinoma. Am. J. Surg., 49:
144 –150, 1985.
6. Yu, F., Venzon, D. J., Serrano, J., Goebel, S. U., Doppman, J. L., Gibril, F., and
Jensen, R. T. Prospective study of the clinical course, prognostic factors and survival
in patients with longstanding Zollinger-Ellison syndrome. J. Clin. Oncol., 17: 615–
630, 1999.
7. Weber, H. C., Venzon, D. J., Lin, J. T., Fishbein, V. A., Orbuch, M., Strader, D. B.,
Gibril, F., Metz, D. C., Fraker, D. L., Norton, J. A., and Jensen, R. T. Determinants
of metastatic rate and survival in patients with Zollinger-Ellison syndrome: a prospective long-term study. Gastroenterology, 108: 1637–1649, 1995.
8. Sutliff, V. E., Doppman, J. L., Gibril, F., Yu, F., Serrano, J., Venzon, D. J., and
Jensen, R. T. Growth of newly diagnosed, untreated metastatic gastrinomas and
predictors of growth patterns. J. Clin. Oncol., 15: 2420 –2431, 1997.
9. Alexander, R. A., and Jensen, R. T. Pancreatic endocrine tumors. In: V. T. DeVita, S.
Hellman, and S. A. Rosenberg (eds.), Cancer: Principles and Practice of Oncology,
6th ed., pp. 1788 –1813. Philadelphia: Lippincott Williams & Wilkins, 2001.
10. Weinberg, R. A. Oncogenes and tumor suppressor genes. CA Cancer J. Clin., 44:
160 –170, 1994.
11. Frauman, A. G., and Moses, A. C. Oncogenes and growth factors in thyroid carcinogenesis. Endocrinol. Metab. Clin. N. Am., 19: 479 – 492, 1990.
12. Fraker, D. L., and Jensen, R. T. Pancreatic endocrine tumors. In: V. T. DeVita, S.
Hellman, and S. A. Rosenberg (eds.), Cancer: Principles and Practice of Oncology,
5th ed., pp. 1678 –1704. Philadelphia: Lippincott-Raven, 1997.
13. Weber, H. C., and Jensen, R. T. Pancreatic endocrine tumors and carcinoid tumors:
recent insights from genetic and molecular biologic studies. In: C. G. Dervenis (ed.),
Advances in Pancreatic Disease. Molecular Biology, Diagnosis and Treatment, pp.
55–75. Stuttgart, New York: Georg Thieme Verlag, 1996.
14. Chung, D. C., Smith, A. P., Louis, D. N., Graeme-Cook, F., Warshaw, A. L., and
Arnold, A. Analysis of the retinoblastoma tumour suppressor gene in pancreatic
endocrine tumours. Clin. Endocrinol. (Oxf), 47: 523–528, 1997.
15. Jensen, R. T. Carcinoid and pancreatic endocrine tumors: recent advances in molecular pathogenesis, localization, and treatment. Curr. Opin. Oncol., 12: 368 –377,
2000.
3708
Downloaded from cancerres.aacrjournals.org on June 28, 2012
Copyright © 2002 American Association for Cancer Research
HER-2/NEU EXPRESSION IN GASTRINOMA
16. Corleto, V. D., Delle Fave, G., and Jensen, R. T. Molecular insights in gastrointestinal
neuroendocrine tumors: importance and recent advances. Dig. Liver Dis., in press,
2002.
17. Goebel, S. U., Heppner, C., Burns, A. D., Marx, S. J., Spiegel, A. M., Zhuang, Z. P.,
Gibril, F., Jensen, R. T., and Serrano, J. Genotype/phenotype correlations of MEN1
gene mutations in sporadic gastrinoma. J. Clin. Endocrinol. Metab., 85: 116 –123,
2000.
18. Wang, E. H., Ebrahimi, S. A., Wu, A. Y., Kashefi, C., Passaro, E., Jr., and Sawicki,
M. P. Mutation of the MENIN gene in sporadic pancreatic endocrine tumors. Cancer
Res., 58: 4417– 4420, 1998.
19. Serrano, J., Goebel, S. U., Peghini, P. L., Lubensky, I. A., Gibril, F., and Jensen, R. T.
Alterations in the p16 INK4a/CDKN2A tumor suppressor gene in gastrinomas.
J. Clin. Endocrinol. Metab., 85: 4146 – 4156, 2000.
20. Muscarella, P., Melvin, W. S., Fisher, W. E., Foor, J., Ellison, E. C., Herman, J. G.,
Schirmer, W. J., Hitchcock, C. L., DeYoung, B. R., and Weghorst, C. M. Genetic
alterations in gastrinomas and nonfunctioning pancreatic neuroendocrine tumors: an
analysis of p16/MTS1 tumor suppressor gene inactivation. Cancer Res., 58: 237–240,
1998.
21. Chung, D. C., Brown, S. B., Graeme-Cook, F., Tillotson, L. G., Warshaw, A. L.,
Jensen, R. T., and Arnold, A. Localization of putative tumor suppressor loci by
genome-wide allelotyping in human pancreatic endocrine tumors. Cancer Res., 58:
3706 –3711, 1998.
22. Bartsch, D., Hahn, S. A., Danichevski, K. D., Ramaswamy, A., Bastian, D.,
Galehdari, H., Barth, P., Schmiegel, W., Simon, B., and Rothmund, M. Mutations of
the DPC4/Smad4 gene in neuroendocrine pancreatic tumors. Oncogene, 18: 2367–
2371, 1999.
23. Kaptain, S., Tan, L. K., and Chen, B. Her-2/neu and breast cancer. Diagn. Mol.
Pathol., 10: 139 –152, 2001.
24. Hung, M. C., and Lau, Y. K. Basic science of HER-2/neu: a review. Semin. Oncol.,
26: 51–59, 1999.
25. Ross, J. S., and McKenna, B. J. The HER-2/neu oncogene in tumors of the gastrointestinal tract. Cancer Investig., 19: 554 –568, 2001.
26. Slamon, D. J., Clark, G. M., Wong, S. G., Levin, W. J., Ullrich, A., and McGuire,
W. L. Human breast cancer: correlation of relapse and survival with amplification of
the HER-2/neu oncogene. Science (Wash. DC), 235: 177–182, 1987.
27. Zhau, H. E., Wan, D. S., Zhou, J., Miller, G. J., and von Eschenbach, A. C. Expression
of c-erb B-2/neu proto-oncogene in human prostatic cancer tissues and cell lines. Mol.
Carcinog., 5: 320 –327, 1992.
28. Aasland, R., Lillehaug, J. R., Male, R., Josendal, O., Varhaug, J. E., and Kleppe, K.
Expression of oncogenes in thyroid tumours: coexpression of c-erbB2/neu and
c-erbB. Br. J. Cancer, 57: 358 –363, 1988.
29. Roncalli, M., Springall, D. R., Varndell, I. M., Gaitonde, V. V., Hamid, Q., Ibrahim,
N. B., Grimelius, L., Wilander, E., Polak, J. M., and Coggi, G. Oncoprotein immunoreactivity in human endocrine tumors. J. Pathol., 163: 117–127, 1991.
30. Bieche, I., Franc, B., Vidaud, D., Vidaud, M., and Lidereau, R. Analyses of MYC.
ERBB2, and CCND1 genes in benign and malignant thyroid follicular cell tumors by
real-time polymerase chain reaction. Thyroid, 11: 147–152, 2001.
31. Castilla-Guerra, L., Moreno, A. M., Fernandez-Moreno, M. C., Utrilla, J. C.,
Fernandez, E., and Galera-Davison, H. Expression and prognostic value of c-erbB-2
oncogene product in human phaeochromocytomas. Histopathology (Oxf.), 31:
144 –149, 1997.
32. Chaidarun, S. S., Eggo, M. C., Sheppard, M. C., and Stewart, P. M. Expression of
epidermal growth factor (EGF), its receptor, and related oncoprotein (erbB-2) in
human pituitary tumors and response to EGF in vitro. Endocrinology, 135: 2012–
2021, 1994.
33. Akslen, LA., and Varhaug, J. E. Oncoproteins and tumor progression in papillary
thyroid carcinoma. Cancer (Phila.), 76: 1643–1654, 1995.
34. Stebbing, J., Copson, E., and O’Reilly. S. Herceptin (trastuzamab) in advanced breast
cancer. Cancer Treat. Rev., 26: 287–290, 2000.
35. Buchler, P., Reber, H. A., Buchler, M. C., Roth, M. A., Buchler, M. W., Friess, H.,
Isacoff, W. H., and Hines, O. F. Therapy for pancreatic cancer with a recombinant
humanized anti-HER-2 antibody (herceptin). J. Gastrointest. Surg., 5: 139 –146, 2001.
36. Ross, J. S., and Fletcher, J. A. The HER-2/neu oncogene: prognostic factor, predictive
factor and target for therapy. Cancer Biol., 9: 125–138, 1999.
37. Wang, D. G., Johnston, C. F., and Buchanan, K. D. Oncogene expression in gastroenteropancreatic neuroendocrine tumors: implications for pathogenesis. Cancer
(Phila.), 80: 668 – 675, 1997.
38. Wilkinson, N., Hasleton, P. S., Wilkes, S., and Quigley, A. Lack of C-erbB-2 protein
expression in pulmonary carcinoid tumors. J. Clin. Pathol., 44: 343, 1991.
39. Koeppen, H. K. W., Wright, B. D., Burt, A. D., Quirke, P., McNicol, A. M., Dybdal,
N. O., Sliwkowski, M. X., and Hillan, K. J. Overexpression of HER-2/neu in solid
tumors: an immunohistochemical survey. Histopathology, 38: 96 –104, 2001.
40. Evers, B. M., Rady, P. L., Sandoval, K., Arany, I., Tyring, S. K., Sanchez, R. L.,
Nealon, W. H., Townsend, C. M., and Thompson, J. C. Gastrinomas demonstrate
amplification of the HER-2/neu proto-oncogene. Ann. Surg., 219: 596 – 604, 1994.
41. Evers, B. M., Rady, P. L., Tyring, S. K., Sanchez, R. L., Rajaraman, S., Townsend,
C. M., Jr., and Thompson. J. C. Amplification of the HER-2/neu protooncogene in
human endocrine tumors. Surgery (St. Louis), 112: 211–217, 1992.
42. Jensen, R. T., and Norton, J. A. Endocrine neoplasms of the pancreas. In: T. Yamada,
D. H. Alpers, C. Owyang, D. W. Powell, and F. E. Silverstein (eds.), Textbook of
Gastroenterology, 3rd ed., pp. 2193–2228. Philadelphia: J. B. Lippincott, 1998.
43. Fishbeyn, V. A., Norton, J. A., Benya, R. V., Pisegna, J. R., Venzon, D. J., Metz,
D. C., and Jensen, R. T. Assessment and prediction of long-term cure in patients with
Zollinger-Ellison syndrome: the best approach. Ann. Intern. Med., 119: 199 –206,
1993.
44. Roy, P., Venzon, D. J., Shojamanesh, H., Abou-Saif, A., Peghini, P., Doppman, J. L.,
Gibril, F., and Jensen, R. T. Zollinger-Ellison syndrome: clinical presentation in 261
patients. Medicine (Baltim.), 79: 379 – 411, 2000.
45. Benya, R. V., Metz, D. C., Venzon, D. J., Fishbeyn, V. A., Strader, D. B., Orbuch, M.,
and Jensen, R. T. Zollinger-Ellison syndrome can be the initial endocrine manifestation in patients with multiple endocrine neoplasia-type 1. Am. J. Med., 97: 436 –
444, 1994.
46. Norton, J. A., Fraker, D. L., Alexander, H. R., Venzon, D. J., Doppman, J. L.,
Serrano, J., Goebel, S. U., Peghini, P., Roy, P. K., Gibril, F., and Jensen, R. T. Surgery
to cure the Zollinger-Ellison syndrome. N. Engl. J. Med., 341: 635– 644, 1999.
47. Frye, R. A., Benz, C. C., and Liu, E. Detection of amplified oncogenes by differential
polymerase chain reaction. Oncogene, 4: 1153–1157, 1989.
48. Jensen, R. T., and Gardner, J. D. Gastrinoma. In: V. L. W. Go, E. P. DiMagno, J. D.
Gardner, E. Lebenthal, H. A. Reber, and G. A. Scheele (eds.), The Pancreas: Biology,
Pathobiology and Disease, 2nd ed., pp. 931–978. New York: Raven Press, 1993.
49. Bonfils, S., Landor, J. H., Mignon, M., and Hervoir, P. Results of surgical management in 92 consecutive patients with Zollinger-Ellison syndrome. Ann. Surg., 194:
692– 697, 1981.
50. Mignon, M., Ruszniewski, P., Haffar, S., Rignaud, D., Rene, E., and Bonfils, S.
Current approach to the management of tumoral process in patients with gastrinoma.
World J. Surg., 10: 703–710, 1986.
51. Mignon, M., Jais, P., Cadiot, G., Yedder, D., and Vatier, J. Clinical features and
advances in biological diagnostic criteria for Zollinger-Ellison syndrome. In: M.
Mignon and R. T. Jensen (eds.), Endocrine Tumors of the Pancreas: Recent Advances
in Research and Management. Series: Frontiers of Gastrointestinal Research, Vol. 23,
pp. 223–239. Basel, Switzerland: S. Karger, 1995.
52. Roy, P., Venzon, D. J., Feigenbaum, K. M., Koviack, P. D., Bashir, S., Ojeaburu,
J. V., Gibril, F., and Jensen, R. T. Gastric secretion in Zollinger-Ellison syndrome:
correlation with clinical expression, tumor extent and role in diagnosis: A prospective
NIH study of 235 patients and review of the literature in 984 cases. Medicine
(Baltim.), 80: 189 –222, 2001.
53. Jensen, R. T. Zollinger-Ellison syndrome. In: G. M. Doherty and B. Skogseid (eds.),
Surgical Endocrinology: Clinical Syndromes, pp. 291–344. Philadelphia: Lippincott
Williams & Wilkins, 2001.
54. Kraus, M. H., Popescu, N. C., Amsbaugh, S. C., and King, C. R. Overexpression of
the EGF receptor-related proto-oncogene erbB-2 in human mammary tumor cell lines
by different molecular mechanisms. EMBO J, 6: 605– 610, 1987.
55. Kallioniemi, O. P., Kallioniemi, A., Kurisu, W., Thor, A., Chen, L. C., Smith, H. S.,
Waldman, F. M., Pinkel, D., and Gray, J. W. ERBB2 amplification in breast cancer
analyzed by fluorescence in situ hybridization. Proc. Natl. Acad. Sci. USA, 89:
5321–5325, 1992.
56. Szollosi, J., Balazs, M., Feuerstein, B. G., Benz, C. C., and Waldman, F. M. ERBB-2
(HER-2/neu) gene copy number, p185HER-2 overexpression, and intratumor heterogeneity in human breast cancer. Cancer Res., 55: 5400 –5407, 1995.
57. Underwood, M., Bartlett, J., Reeves, J., Gardiner, D. S., Scott, R., and Cooke, T.
C-erbB-2 gene amplification: a molecular marker in recurrent bladder tumors? Cancer
Res., 55: 2422–2430, 1995.
58. Friedrichs, K., Lohmann, D., and Hofler, H. Detection of HER-2 oncogene amplification in breast cancer by differential polymerase chain reaction from single cryosections. Virchows Arch. B. Cell Pathol., 64: 209 –212, 1993.
59. Hanna, W. M., Kahn, H. J., Pienkowska, M., Blondal, J., Seth, A., and Marks, A.
Defining a test for HER-2/neu evaluation in breast cancer in the diagnostic setting.
Mod. Pathol., 14: 677– 685, 2001.
60. Supanaranond, K., Sukarayodhin, S., Tanyakaset, M., Balachandra, K., Jullaksorn,
D., Rienkijkarn, M., Hoisanka, N., and Tantivanich, S. The significance of HER-2/
neu/c-erbB-2 gene amplification in benign and malignant breast disease. Southeast
Asian J. Trop. Med. Public Health, 28: 631– 640, 1997.
61. Lonn, U., Lonn, S., Friberg, S., Nilsson, B., Silfversward, C., and Stenkvist, B.
Prognostic value of amplification of c-erb-B2 in bladder carcinoma. Clin. Cancer
Res., 1: 1189 –1194, 1995.
62. Colomer, R., Lupu, R., Bacus, S. S., and Gelmann, E. P. erbB-2 antisense oligonucleotides inhibit the proliferation of breast carcinoma cells with erbB-2 oncogene
amplication. Br. J. Cancer, 70: 819 – 825, 1994.
63. Pegram, M. D., Finn, R. S., Arzoo, K., Beryt, M., Pietras, R. J., and Slamon, D. J. The
effect of HER-2/neu overexpression on chemotherapeutic drug sensitivity in human
breast and ovarian cancer cells. Oncogene, 15: 537–547, 1997.
64. Hall, P. A., Hughes, C. M., Staddon, S. L., Richman, P. I., Gullick, W. J., and
Lemoine, N. R. The c-erbB-2 proto-oncogene in human pancreatic cancer. J. Pathol.,
161: 195–200, 1990.
65. Scher, H. I. HER-2 in prostate cancer–a viable target or innocent bystander? J. Natl.
Cancer Inst., 92: 1866 –1868, 2000.
66. Tsongalis, G. J., and Ricci, A., Jr. Her2: the neu prognostic marker for breast cancer.
Crit. Rev. Clin. Lab. Sci., 38: 167–182, 2001.
67. Tsugawa, K., Fushida, S., and Yonemura, Y. Amplification of the c-erbB-2 gene in
gastric carcinoma: correlation with survival. Oncology, 50: 418 – 425, 1993.
68. Johnson, R. C., Ricci, A., Jr., Cartun, R. W., Ackroyd, R., and Tsongalis, G. J.
p185HER-2 overexpression in human breast cancer using molecular and immunohistochemical methods. Cancer Investig., 18: 336 –342, 2000.
69. Seki, A., Yoshinouchi, M., Seki, N., Kodama, J., Miyagi, Y., and Kudoh, T. Detection
of c-erbB-2 and FGF-3 (INT-2) gene amplification in epithelial ovarian cancer. Int.
J. Oncol., 17: 103–106, 2000.
70. To¨ nnies, H., Toliat, M. R., Ramel, C., Pape, U. F., Neitzel, H., Berger, W., and
Wiedenmann, B. Analysis of sporadic neuroendocrine tumors of the enteropancreatic
system by comparative genomic hybridization. Gut, 48: 536 –541, 2001.
71. Terris, B., Meddeb, M., Marchio, A., Danglot, G., Fiejou, J. F., Beghiti, J.,
Ruszniewski, P., and Bernheim, A. Comparative genomic hybridization analysis of
3709
Downloaded from cancerres.aacrjournals.org on June 28, 2012
Copyright © 2002 American Association for Cancer Research
HER-2/NEU EXPRESSION IN GASTRINOMA
72.
73.
74.
75.
76.
77.
78.
79.
80.
81.
sporadic neuroendocrine tumors of the digestive system. Genes Chromosomes Cancer, 22: 50 –56, 1998.
Speel, E. J., Richter, J., Moch, H., Egenter, C., Saremaslani, P., Rutimann, K., Zhao,
J., Barghorn, A., Roth, J., Heitz, P. U., and Komminoth, P. Genetic differences in
endocrine pancreatic tumor subtypes detected by comparative genomic hybridization.
Am. J Pathol., 155: 1787–1794, 1999.
Kyto¨ la¨ , S., Ho¨ o¨ g, A., Nord, B., Cedermark, B., Frisk, T., Larsson, C., and Kjellman,
M. Comparative genomic hybridization identifies loss of 18q22-qter as an early and
specific event in tumorigenesis of midgut carcinoids. Am. J. Pathol., 158: 1803–1808,
2001.
Ezzat, S., Zheng, L., Smyth, H. S., and Asa, S. L. The c-erbB-2/neu proto-oncogene
in human pituitary tumours. Clin. Endocrinol. (Oxf), 46: 599 – 606, 1997.
Sugg, S. L., Ezzat, S., Zheng, L., Freeman, J. L., Rosen, I. B., and Asa, S. L.
Oncogene profile of papillary thyroid carcinoma. Surgery (St. Louis), 125: 46 –52,
1999.
Schneider, P. M., Hung, M. C., Chiocca, S. M., Manning, J., Zhao, X., Fang, K., and
Roth, J. A. Differential expression of the c-erbB-2 gene in human small cell and
non-small cell lung cancer. Cancer Res., 49: 4968 – 4971, 1989.
Kuhn, E. J., Kurnot, R. A., Sesterhenn, I. A., Chang, E. H., and Moul, J. W.
Expression of the c-erbB-2 (HER-2/neu) oncoprotein in human prostatic carcinoma.
J. Urol., 150: 1427–1433, 1993.
Wood, D. P., Wartinger, D. D., Reuter, V., Cordon-Cardo, C., Fair, W. R., and
Chaganti, R. S. K. DNA. RNA and immunohistochemical characterization of the
her-2/neu oncogene in transitional cell carcinoma of the bladder. J. Urol., 146:
1398 –1401, 1991.
Mellon, J. K., Lunec, J., Wright, C., Horne, C. H. W., Kelly, P., and Neal, D. E.
C-erbb-2 in bladder cancer: molecular biology, correlation with epidermal growth
factor receptors and prognostic value. J. Urol., 155: 321–326, 1996.
Aunoble, B., Sanches, R., Didier, E., and Bignon, Y. J. Major oncogenes and tumor
suppressor genes involved in epithelial ovarian cancer (Review). Int. J. Oncol., 16:
567–576, 2000.
Gupta, D., Shidham, V., Holden, J., and Layfield, L. Value of topoisomerase II ␣.
MIB-1, p53, E-cadherin, retinoblastoma gene protein product, and HER-2/neu immunohistochemical expression for the prediction of biologic behavior in adrenocortical neoplasms. Appl. Immunohistochem. Mol. Morphol., 9: 215–221, 2001.
82. Haugen, D. R., Akslen, L. A., Varhaug, J. E., and Lillehaug, J. R. Demonstration of
a TGF-␣-EGF-receptor autocrine loop and c-myc protein over-expression in papillary
thyroid carcinomas. Int. J. Cancer, 55: 37– 43, 1993.
83. Auguste, L. J., Masood, S., Westerband, A., Belluco, C., Valderamma, E., and Attie,
J. Oncogene expression in follicular neoplasms of the thyroid. Am. J. Surg, 164:
592–593, 1992.
84. Soda, G., Antonaci, A., Bosco, D., Nardoni, S., and Melis, M. Expression of bcl-2,
c-erbB-2, p53, and p21 (waf1-cip1) protein in thyroid carcinomas. J. Exp. Clin.
Cancer Res., 18: 363–367, 1999.
85. Haugen, D. R. F., Akslen, L. A., Varhaug, J. E., and Lillehaug, J. R. Expression of
c-erbB-3 and c-erbB-4 proteins in papillary thyroid carcinomas. Cancer Res., 56:
1184 –1188, 1996.
86. Haugen, D. R. F., Akslen, L. A., Varhaug, J. E., and Lillehaug, J. R. Expression of
c-erbB-2 protein in papillary thyroid carcinomas. Br. J. Cancer, 65: 832– 837, 1992.
87. DeKruger, R. R., Van DerHarst, E., Van Der Ham, F., Stijnen, T., Dinjens, W. N. M.,
Koper, J. W., Bruining, H. A., Lamberts, S. W. J., and Bosman, F. T. Prognostic value
of p53, bcl-2, and c-erbB-2 protein expression in phaeochromocytomas. J. Pathol.,
188: 51–55, 1999.
88. Thomson, T. A., Hayes, M. M., Spinelli, J. J., Hilland, E., Sawrenko, C., Phillips, D.,
Dupuis, B., and Parker, R. L. Her-2/neu in breast cancer: interobserver variability and
performance of immunohistochemistry with 4 antibodies compared with fluorescent
in situ hybridization. Mod. Pathol., 14: 1079 –1086, 2001.
89. Yonemura, Y., Ninomiya, I., Tsugawa, K., Fushida, S., Fijimura, T., Miyazaki, I.,
Uchibayashi, T., Endou, Y., and Sasaki, T. Prognostic significance of c-erbB-2 gene
expression in the poorly differentiated type of adenocarcinoma of the stomach.
Cancer Detect. Prev., 22: 139 –146, 1998.
90. Novotny, J., Petruzelka, L., Vedralova, J., Kleibl, Z., Matous, B., and Juda, L.
Prognostic significance of c-erbB-2 gene expression in pancreatic cancer patients.
Neoplasma (Bratisl.), 48: 188 –191, 2001.
91. Gibril, F., Venzon, D. J., Ojeaburu, J. V., Bashir, S., and Jensen, R. T. Prospective
study of the natural history of gastrinoma in patients with MEN1: Definition of an
aggressive and a nonaggressive form. J. Clin. Endocrinol. Metab., 86: 5282–5293,
2001.
92. Arnold, W. S., Fraker, D. L., Alexander, H. R., Weber, H. C., and Jensen, R. T.
Apparent lymph node primary gastrinoma. Surgery (St. Louis), 116: 1123–1130, 1994.
3710
Downloaded from cancerres.aacrjournals.org on June 28, 2012
Copyright © 2002 American Association for Cancer Research